Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14710F2
Clone ID IST14710F2
Vector VICTR76
Project tigm

Sequence tag IST14710F2HMR1
Sequence
GGGGAGGGAGCACCAACCACCAAGGGAAGGGAAACAAACTTCCCTAAAGAAGCCTAAGTCACTGCTCTTGCTGGGAGGAG
CATAACCAAGCAGCTGTCCCTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15127213..15127314 102
NO GENE  


Sequence tag IST14710F2HMF1
Sequence
CCCTCCACCCCCCACAGGCAGGCTGTACTGAACAAGGGCTCCCCACTACAGTTCCAGCTGCAGGATGGGGTGAGTGCCCT
CTTTGAGACTTGCATTTCCCATCAGTTTATAAGCAAGCCAAGAACTGCCAGGAAACCCTGCCATTCACTCTTCATCTGCC
CAGAACACTGACAGAATGTTTCTCTGTCAATTCTAAAAGGAATTCTTGTGGGATTTCCTGAACTATCAGGAGGGTCCTCG
TATCCGGGATCATTTAAGCCATGGGGAGATCAACATACGTGAATTTCCAGAAGAGGCCGCAGGCCAGCTGCTCACATTCT
CCCTGGTGCTGCTGCTCANATTCACTGANAAGGGGACAGTGTCNNANCTGANNGTACCACAGANGGAGGGAGGAGGGTGN
CTGGCNNAAN
Sequence Type genomic DNA
Unitrap ID UNI1957

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15127312..15127716 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079709 (AC182749.2-203) NP_001116842 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:Q8C5D3]

 
Come back to gene ENSMUSG00000079709


For any suggestions or comments, please send an email to unitrap@crg.es