Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14639G1
Clone ID IST14639G1
Vector VICTR74
Project tigm

Sequence tag IST14639G1HMF1
Sequence
ATCCAGGCCTTTTGGTTTTTTTGTAGCAGTAGTTGCTACAAAAATGGATACACACATATTATACAAAGTGTTTATATAGT
TACAATGTATACCAAACAGTCGAAAGCATTCTTTAAAATGCTGATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 148666957..148667086 130
NO GENE  


Sequence tag IST14639G1BBF2
Sequence
GTGGCACACGCCTTTAATCCCAGCACTCGAGNGGCGGAGGCAGGCAGATTTCTGAGTTTGAGGCCAGCCTGGTCTACAAA
GTGAGTTCCAGGC
Sequence Type genomic DNA
Unitrap ID UNI35505 UNI35506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47850640..47850731 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24299348..24299439 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 43176423..43176514 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 86085496..86085587 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22888314..22888405 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45736371..45736462 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035382 (Pcsk7) NM_008794 proprotein convertase subtilisin/kexin type 7 Gene [Source:MGI Symbol;Acc:MGI:107421]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 77932377..77932468 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82774504..82774595 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 99915105..99915196 86
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128615419..128615510 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014361 (Mertk) NM_008587 c-mer proto-oncogene tyrosine kinase Gene [Source:MGI (curated);Acc:Mertk-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 138472760..138472851 86
NO GENE  

 
Come back to gene ENSMUSG00000014361


For any suggestions or comments, please send an email to unitrap@crg.es