Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10758G3
Clone ID IST10758G3
Vector VICTR76
Project tigm

Sequence tag IST10758G3HMF1
Sequence
CTGCCCCTGACCNGGCTTCATGCTCAAATCTGTGAAGTCTACTGAGGGCATCGATACTCAGTCTAACGAAGTTATTATGA
AGACTGGATACTGTGACAGAAACTTCAGGAGTCAGGACTCTGGGGGAGTGACTATGGGCATCTAGCTACACTGTANCTTA
TCTCTTGACTTCTTANAGAGCTGATGTCACTTTGAGCCCATCAAAAAAGTTCCCAAAGCCATAATATACTTANGCCTCTT
TTCTTCCTTAAGCGGTCNTNANNCCANCGTATAAAAAGTCATAAAATGGATTATATCCTTTGTGTGAATAACTTACTTCC
TANAATTTANATTAAGGAAATAATTAAAAAGAAAGGGCCTCCANGTACNAAAGCANTCTTGGCAGCACCATTCCTAACAT
GGGAAGGCAGGAAGTGTGTGGCANGCNANNAGCTGGTGCATCACGGGCACCTCGGGACTTCACTGAAANGACNGCNCACC
GGGCATATAAACACTGTGGTCNNGCCN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10758G3HMR1
Sequence
CTTANCACAGGGNNGNNGCCCTGGAGAGCCTTGTCAGCTCCCCTCACCCTGGAGCTGGGCTGGGCTGCCTTGGAATTCAC
TTCAGAGCCAGCTAAGGAGCTGCTCCAAGCAGTCTGCCTGCCTCCAAGCCTCGCACCTTGTGCATGACCAAAGATGGAAT
CCTTGAGCCCCATGCCCCACCTGACTCACTGTATTGGAACCAGCCACACTGGGCTCTCTCCAGAAGCCAGCTCCTTCTCC
GGAGGAGGAAGTTCTGCCAGCTCTGAGGATGGGGGGCGGGACAGTGAGTGAGGAGTGGCTCCTGCTTTGAAAGGCTTCTA
GAGTCAGCTGAACTGATGTGAGACCTGGCTATCCT
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157199416..157199770 345
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es