Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14153H3
Clone ID IST14153H3
Vector VICTR74
Project tigm

Sequence tag IST14153H3HMR1
Sequence
CTCTCAGCTAAGACNNGTTGGTTCCCATTCACAGCCTTGGACAGTTACACCGGTCTCTGACCCTCAGTTGCTTCTTCAAG
GATCCTTAAGTACACACTCCCTTGTCCATCTTTCCCATTTCTGAGCTCGGATACCTTGGTGGATCTCCATATCCTCTCCA
AGGGCACTTAAAGCCAGGGGATATGGCAGACACCCAGAGAACAGGAATCACAGCAGCGAGCTCACAGTGACCTGACACAT
TGCTACTCGCTCAATTTCACTGCGATCCTTGCAGTGGATTTTANTCCCACGGTTTTTACGGAAAGAACTGAGGCACTTAN
AAAGGAGCATANAGCCATAATTCCGGCCCGGCTGCTGGCCCTGGGTGCTGCCCTCTCGTGGTACNCGTCTATTGNGTCCT
TGTGCANATGGAAAATCNNTTCTCTCCTGCCCCCTGCTGN
Sequence Type genomic DNA
Unitrap ID UNI35508

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 53056524..53056962 419
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062044 (Lmtk3) NM_001005511 lemur tyrosine kinase 3 Gene [Source:MGI (curated);Acc:Lmtk3-001]

 
Come back to gene ENSMUSG00000062044


For any suggestions or comments, please send an email to unitrap@crg.es