Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14485A6
Clone ID IST14485A6
Vector VICTR74
Project tigm

Sequence tag IST14485A6HMF1
Sequence
CTTTTCTGTGCACCCCTCCACCTCACCCCCTCACCCCTACCAGCACAGCTGGAAAGTAGTGAAGGGGACACAGTGGCTGA
GGAAAGGAAGAACACAGGATCCAGTAAGAATCAGGGACTTTGTTCCAGTGTGAATTGGTGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956603..128956746 144
NO GENE  


Sequence tag IST14485A6BBF1
Sequence
CTTTTCTGTGCACCCCTCCACCTCACCCCCTCACCCCTACCAGCACAGCTGGAAAGTANTGAAGGGGACACAGTGGCTGA
GGAAAGGAANAACACAGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956646..128956746 97
NO GENE  


Sequence tag IST14485A6HMR1
Sequence
AAAGGATCTTGCTAATGTATACAATACATAAATACATATACAATATGTCTGAAATACTAAACTGTTATTGATGTANCCNT
TAGGAAAAAGTCTTTAAAATGTTCTGGATTTGGCAGAAATGGAGGAAAGCGTGAGAAACCCTCCCTCCCTTGCTGCTCTT
GCTGGATCTCTCCAAGGGAAAGTTCACACCTTCGACCGCCCTCATCTGAGCACCTCTGGGCTCTCTGTCCCTGCANCTCT
GCCTTTTCTTTCTCGCCTTCTTTTGGGCTAGTGTGTTGGCTCATCTTGTCCTTTCCNNTCCTTATGTGANGGTCNNANAA
TGGACTCNNANGACATCTN
Sequence Type genomic DNA
Unitrap ID UNI12980

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 128956743..128957080 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037938 (Chchd5) NM_025395 coiled-coil-helix-coiled-coil-helix domain containing 5 Gene [Source:MGI (curated);Acc:Chchd5-001]

 
Come back to gene ENSMUSG00000037938


For any suggestions or comments, please send an email to unitrap@crg.es