Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14251B7
Clone ID IST14251B7
Vector VICTR74
Project tigm

Sequence tag IST14251B7HMF2
Sequence
TTTTAAAGATTTATTTATTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTTGT
TACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCTGGACCTTTGGAAGAGCAGTCGGGTGCTCTTACCC
ACTGAGCCATCTCACCAGCCCTTATTATGCATTTTAATTAAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154175239..154175439 189
 
EST/CDNA Est Name
  BG292822.1


Sequence tag IST14251B7HMR1
Sequence
AAAAAATGCATAATAAATGAAAAATATAACCAGTCTTCTTGGAACTCCTTTCCAGTAACTCAGACTGAAGACTAAGCTAG
CTGCAAAGTTACAGTGATCCACCTCCCTCTGCCACCACCACCACCACCACTGCCTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 74916871..74917006 130
NO GENE  


Sequence tag IST14251B7BBF1
Sequence
TTTTAAAGATTTATTTATTATTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGGAGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI9397 UNI13618 UNI31884 UNI33825 UNI35510

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6290676..6290752 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024772 (Ehd1) NM_010119 EH-domain containing 1 Gene [Source:MGI (curated);Acc:Ehd1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 38502739..38502815 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15109892..15109968 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 28778045..28778121 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 33974299..33974375 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 32890047..32890123 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 25442685..25442761 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5650300..5650376 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106161751..106161827 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14751567..14751643 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079357 (AC171681.1)  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 69124185..69124261 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069601 (Ank3) NM_170687 ankyrin 3, epithelial Gene [Source:MGI Symbol;Acc:MGI:88026]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 13131029..13131105 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031446 (Cul4a) NP_666319 cullin 4A Gene [Source:MGI (curated);Acc:Cul4a-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 39404343..39404419 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3234146..3234222 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 99234988..99235064 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 36905107..36905183 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 19909961..19910037 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 33398962..33399038 77
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 119393357..119393433 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000014077 (1500003O03Rik) NM_019769 RIKEN cDNA 1500003O03 gene Gene [Source:MGI Symbol;Acc:MGI:1927185]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 38129059..38129135 77
NO GENE  

 
Come back to gene ENSMUSG00000014077


For any suggestions or comments, please send an email to unitrap@crg.es