Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14631B5
Clone ID IST14631B5
Vector VICTR74
Project tigm

Sequence tag IST14631B5HMF1
Sequence
ATTAAATAAAAGACCATATCTAGCTTTATCTAGACCTCTCTCTTCAGAGCTAGAGACTAAACCCAGGGTCTTATATTTGC
TAGGTAAGTGTTGGACTGAGCGGTCACAGCTCCTGGCTGGGAGTGTGACTTTAAATAAGGCAGCTTTATATTTCTAACTA
GATCAGTGGAGGCAGCCTCATAGCTGAGATCCACACTGGTGCTGCCTAGTTCCCGAACTGTCCTAGCGCAATCAGAAGCA
GCAGCTCCTCACCACACTCTCTTCAGTTATCCAGCAACTACTCCTCGCCAACTCTCTTGTTATACAACACAATCCAGCTG
ACGTAATAAGCAAAATCCAGGAACGTCTTANGCACGCACCTAAGGAGATTTGGAANCTGATCAACCTTAGACCTANGGAA
ACCTGGAACAATGAAGTGCACACCAACACNNCATGACNNGGACCAGCANCCCAANGCTGCCATCTGCTGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51038528..51038998 453
NO GENE  


Sequence tag IST14631B5HMR1
Sequence
NNTNTNNNGNGGGGCGATGGGAGACTGGGTCTAGCTGTGTAACCCCAGCTGGCCTGAAACTGTAAAGACCAGGTCGGCCT
TGAACTTGAAGCACTCTTTACATTAAATTCTTTAGGAGGAGAAGGTGGTCCGTGCCTCTCATCTCANCACTCTGGAGGCA
GCGAAAGGCTGGGGAGCTCTGAGTTTGAGGCCNNCCTGGCGTCTATAGAGCTAGTTCTAGGGTACCCAAGGCTCCACGAA
NAAATCCTGTCC
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51039006..51039246 233
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es