Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10782H1
Clone ID IST10782H1
Vector VICTR76
Project tigm

Sequence tag IST10782H1HMF1
Sequence
GGTCTTTCTGAGGCTAGGAGAGCATCTGTCTACCCACTGGTGGGCAATGTCTGCAGAATTCTTTCNGAGCTCACGTGTGG
GGAGAGTGGAATGGGGACCTCTCCTGAATTCTAGAATCTGGATTTAGGGTGGGAGTTTCCTCTCCTCCCCAGATCTGCCG
ATCCAGCTATATATACCTCAGGACTCAGATCTATAAGGAACGTGTTTGGACAAAGCAAGCCTGANCANTGGANGGACCTA
NCTAGAAAANANAAACTTACCTCTTCTGAGGAAAGAGCACAGAAATGGA

Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025162..71025449 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]


Sequence tag IST10782H1BBF1
Sequence
GGTCTTTCTGAGGCTAGGAGAGCATCTGTCTACCCACTGGTGGGCAATGTCTGCAGAATTCTTTNNGAGCTCACGTGTGG
GGAGAGTGGAATGGGGACCTCTCCTGAATTCTAGAATCTGGATTTAGGGTGGGAGTTTCCTCTCCTCCCCAGATCTGT

Sequence Type genomic DNA
Unitrap ID UNI11419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 71025293..71025449 153
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022099 (Epb4.9) NM_013514 erythrocyte protein band 4.9 Gene [Source:MGI Symbol;Acc:MGI:99670]

 
Come back to gene ENSMUSG00000022099


For any suggestions or comments, please send an email to unitrap@crg.es