Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14521C11
Clone ID IST14521C11
Vector VICTR74
Project tigm

Sequence tag IST14521C11HMR1
Sequence
NCNNCCNATCCATGGGATGGATTCCTCTCTCACAAACAAAACAAAACAAGACAAAACAAAACCGACCTTGGCGACGAGCC
TAGATCGCAAGACGTAGTCTAAGCTAAACTGGCTGGCAACTATTGTCTTAGGACTTANAAGTCATGTTANTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222689..55222836 142
NO GENE  


Sequence tag IST14521C11HMF1
Sequence
GGTTAGTTTGACAGTTTTACCAAAGAAGAGCAAATCTATAATACTGAGTGGATTTTGCTGAGAATCCAAAAGCAAACCGA
ATTAAGGAGGAACTGCTC
Sequence Type genomic DNA
Unitrap ID UNI31229

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55222589..55222685 97
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022179 (4931414P19Rik) NM_028890 RIKEN cDNA 4931414P19 gene Gene [Source:MGI Symbol;Acc:MGI:1921609]

 
Come back to gene ENSMUSG00000022179


For any suggestions or comments, please send an email to unitrap@crg.es