Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST471810
Clone ID OST471810
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST471810
Sequence
CGCACACATGTGCACAGAATAGCCAACAGACTGAGGTGGACCAAGAAGATGACCAAGACCCCAGAAGAGACACGCAAGAA
CTTGGAAGAGTGGCTACCCAGGGTGCTATGGAGTGAGGTCAACGGACTACTGGTAGGCTTCGGCCAACAGATCTGTCTTC
CTGTCCATCCTCGATGTCAGGCTTGCCTCAACAAGGCCCTGTGCCCTGCTGCCCAGGATCTCTAAGGGCCATAGGGCTTC
CTCTGGCTAGTGTCTGTGAGGTGCCTTTGTGGGGCGGGGTGGTAAACCTTTGGGGGGTGTTTGCAATAAACCTGGGAAGT
TTTTCACAGTTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI15847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24775376..24775781 227
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041429 (Nthl1) NM_008743 nth (endonuclease III)-like 1 (E.coli) Gene [Source:MGI Symbol;Acc:MGI:1313275]

 
Come back to gene ENSMUSG00000041429


For any suggestions or comments, please send an email to unitrap@crg.es