Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10788E8
Clone ID IST10788E8
Vector VICTR76
Project tigm

Sequence tag IST10788E8HMF1
Sequence
TTGTGACCTGATGTGGAGGGACTCCGGGGCCATTTTTAGGTCAAGAGCAAAGCGAAGCGGTGGAAACTTGAGACCGTGCG
GTCTGCGGGAGTGCGGTGGA

Sequence Type genomic DNA
Unitrap ID UNI31806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148274383..148274480 98
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028977 (Casz1) NM_027195 castor homolog 1, zinc finger (Drosophila) Gene [Source:MGI (curated);Acc:Casz1-004]

 
Come back to gene ENSMUSG00000028977


For any suggestions or comments, please send an email to unitrap@crg.es