Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13096A10
Clone ID IST13096A10
Vector VICTR76
Project tigm

Sequence tag IST13096A10BBF1
Sequence
CCATCACTAGGACCCTTTGTCAGATGCCCCCTACTGTGCGCCCTTTATTCCTCCTCTTCCTCCTCAGTCTGCCTCANCGA
CTTTTTTTCATAAATATCATCTTGTGATCCAGCCACTTCTTCCCCTCTCCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 182477798..182477932 131
NO GENE  


Sequence tag IST13096A10HMF1
Sequence
GTTAAGACTCACTTTGAGAAATGAAGTTGATATTGAATAACATTTGAAAACTATAAGACTACTTGAATGAGAAACACCAA
GTTACAGGTCAGTCTTGATATAACGTGTGAACCAGCAGTCATTTTTAGAAGATGAGGTTCTCTTCCTTCTAAATTANAAG
AAAATGTTTATAACCATTTGAGAAGTAATCTAATCCTTCAGTAGTTTTTATGTGAAGACTCACAGGTCATTGAACTACAT
TGTACTAGCCAAGGATAGCTATCTTGGTTGTTTCTTTGCCTCCTGACTCAGCCTCCCAAGTGCTAGGATTAGGACTGTGC
ACCACTCCCAAAGATTGTGCTTTTTAAAATTTTGTCCTCTTTGGAACTGGAGAGATGGCTCANTGGTTACGTGTGTTTGT
TGTTCTNAGTTCCCAGCACCCACATAGTGGTTCATAACTTCNGTTCCNGANAATCTGATGCCTTACCNTCTCTGCAGTCT
CCCCANGCANGCTCATATACCTATNCCGGANGGTTTTGTGCNCTGTGTATTCANATGCTGANTTCTATGN
Sequence Type genomic DNA
Unitrap ID UNI4447

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 35506790..35507338 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041408 (Wapal) NM_001004436 wings apart-like homolog (Drosophila) Gene [Source:MGI (curated);Acc:Wapal-001]

 
Come back to gene ENSMUSG00000041408


For any suggestions or comments, please send an email to unitrap@crg.es