Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12238B2
Clone ID IST12238B2
Vector VICTR76
Project tigm

Sequence tag IST12238B2HMF1
Sequence
CTCTGCCTCCCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTA
Sequence Type genomic DNA
Unitrap ID UNI3618 UNI31127 UNI31519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48662540..48662589 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714826..23714875 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3343457..3343506 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026648 (Dclre1c) NM_146114 DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dclre1c-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135200075..135200124 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST12238B2BBF1
Sequence
CTCTGCCTCCCGAGTGCTGAGATTAAAGGCGTGCACCACCACACCCGGCTA
Sequence Type genomic DNA
Unitrap ID UNI3618 UNI31127 UNI31519

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 23714826..23714875 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062012 (Zfp13) NM_011747 zinc finger protein 13 Gene [Source:MGI Symbol;Acc:MGI:99159]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 48662540..48662589 50
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135200075..135200124 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3343457..3343506 50
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026648 (Dclre1c) NM_146114 DNA cross-link repair 1C, PSO2 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Dclre1c-002]

 
Come back to gene ENSMUSG00000026648


For any suggestions or comments, please send an email to unitrap@crg.es