Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14739D4
Clone ID IST14739D4
Vector VICTR76
Project tigm

Sequence tag IST14739D4HMR1
Sequence
NGNACACCAAAACNNACAACAAAACCTGAACAACTAAACCCGCTCCTCCTAAATCCACAAAGCAAACAAAACAGGAAACA
GAGAGAANATAGCATTTTACATATTCATACGATGATTTTACATATTCATACGATGCAGGGGATTAAACTCCTCTTTTTAA
CACTTGTCCCCCTTGTTTCCTCTTCTTTAATGTGTTCCCGGTCACATGTGTGTGTGTCCTCGGTCCTCTGGATTCTTGGT
TCTTCCCAGTGAGATGCACTCAGGAAAGCTTCNCTTTACCTGGGGGCTTTACTTTATTGTGCTCCGGGCTTCTCCGCAGA
TGGGCTCTGGGGCTGTCCTCTCCAAAGGCAATCTCTCCATTANCCNCTCTGTGCTGCNNNANANGTCCAGGGTCAAAGCT
GGGTTGGGGANTCTNTNNGNNCGGGCCTNANNANTAN
Sequence Type genomic DNA
Unitrap ID UNI29812

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 93264698..93265122 391
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029381 (Shroom3) NM_001077595 shroom family member 3 Gene [Source:MGI Symbol;Acc:MGI:1351655]


Sequence tag IST14739D4HMF1
Sequence
CCANTATCTTTACCTTCAAGTGAAAGAAAAAAAAGTACCANAGATTACTAAAAACCATGTTTAGAGTCCATCACCACTTT
TTCAGAAATCAAAAAAACAAAACAAAACACACCCAAGCTGAACACCTGTGGCTTTGCTAAGCAAAAAAAAACTTCTCCAC
AAAATACTGTGGTTGAACCCATAATGTGTCAAATCATCACTCACCANGGGCGGAAAANCACACGTTTTCACACTTTCTTT
GCNCACATTTNNGCCTTTCCCTGGCTGTGCCNNCNCCATAGGGTTTGTCTACAGGTCTGGTTTNATANTANNGAANGGCT
GGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14739D4BBF1
Sequence
ANAAAAAAAAGTACCAGAGATTACTAAAAACCATGTTTAGAGTCCATCACCACTTTTTCAGAAATCAAAAAAACAAAACA
AAACACACCCAAGCTGAACACCTGTGGCTTTGCTAAGCAAAAAAAAACTTCTCCACAAAATACTGTGGTTGAACCCATAA
TGTGTCAAATCATCACTCANCAAGGGCGGAAAANCACACNTTTTCACACTTTCTTTGCACACATTTCTGCCTTTCCCTGG
CTGTGCCANCACCATANGGTTTGTCTACAGGTCTGGTTTTATANTAAGGAATGGCTGGCCCANCCTACTGGCTTTGGCTG
GACCNANGATGGTCCGGTNCTTGNNNTGGTATCTCCATTGTCCTTTCTAANGGAAAACNATCANCTTGCTCNCNCCTTTC
TTGCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029381


For any suggestions or comments, please send an email to unitrap@crg.es