Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14216B8
Clone ID IST14216B8
Vector VICTR74
Project tigm

Sequence tag IST14216B8BBF1
Sequence
CACAGANAACTCCAGAAACAGCTCAACAAACTCACCCTTCCATGATAAATTCCTGGGCATATTCATAACAAAAGTCAGAC
AGATTTTGTTTTCAGTCACGTAGTTCTATAAAAATAAACTGTCATCACAACATCCTTGCAGGAGTAAAAGGCCATATTTG
CCCGCAGTTAAATCCAACAGCANCTGTTCTATGGAAAAAGAGGGCCCAATAATTGGCTTCTTTCACCTCTGTTAATCACG
AACAAAAGTGTCATTCAGTTTCAAAATGGACAAAATGGTCCAATGGATGGTCAGCTANCTNANCCAATGGGTGGAANAAC
AATANCCNTGTANCATTTCCCTTTGCCTTTTGTTTGGTCTTTCAAAGCCCTTAATTAANACCTGCNCANANCACTCCTCN
GGGCTTTTCTCANNNANGCATTACATGCCNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14216B8HMR1
Sequence
TGTGAAAATAGCAAATATGTAGTGTATAATTCACATGTGCATATTTTAGCATCTTCTGATGTGAGGATTCANTGTTAGAA
ATCTCTTTTTTTACTCTACATTTGCAGCTCTCAGCCTTATCCTGTTTAACTTTTATAGGAAACTCATAATTTATTAAAGG
TGGGAAGCAATCAGTGGAAGACTGANTGATCTTGAGTAAGCGTCNAGCTATTCTGATACAGACTTCTTAAGTGGGACANA
TGANTCCCANAGACCNCCTACCCTTANTGGGAAGTCCCANCTCCACCCTTCAGGGCTANNANTGANTTTGGGGGACTCTC
CCTTGGGTTTTGGTATN
Sequence Type genomic DNA
Unitrap ID UNI1452

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 109783801..109784136 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050199 (Lgr4) NM_172671 leucine-rich repeat-containing G protein-coupled receptor 4 Gene [Source:MGI (curated);Acc:Lgr4-002]

 
Come back to gene ENSMUSG00000050199


For any suggestions or comments, please send an email to unitrap@crg.es