Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14765F4
Clone ID IST14765F4
Vector VICTR76
Project tigm

Sequence tag IST14765F4BBF1
Sequence
CAGTGGCTCATCGGTGGCAGAGGAGGTGGCAAGAGCGAGTGATTCGAGTACATTCAGAGGAAGCGCCCCCAGCGCTTGCT
GGTGTATCAGGAGTGTGGGTGTTCAGAGAGGGAGGCTTGAGAGTGATCCTCAGACTTCGGGGTGAGTGGAGGAAGCTACT
GATGGCTGGGGGATGGGGACTGGATAGGGACTCCCTCTTCTTGTAAGTGAGGAGTCAGAGTCGGGTTTAGACCAAGTTCT
AAAGGTCAATCCTACTAGCTGCCATGAGGATGCTGAAAAGATTAATACTGAACACACTGTACCACGTGCCAAGTGCTTCA
TGGGTATTCGCCCTTANGGAAAGGGCTGCNATTNNCTCCATCCCCCTGNNNANGAGACNGGCTCANAACGGGATGCTGTG
GGTAGTGTGAGANAAAGCCNNACNNTNTCCACTGGAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157235597..157236032 404
 
EST/CDNA Est Name
  W80148.1


Sequence tag IST14765F4HMR1
Sequence
CTTTNACCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTCTTTN
Sequence Type genomic DNA
Unitrap ID UNI33659 UNI35525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 27943796..27943841 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101314061..101314106 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021638 (Ocln) NM_008756 occludin Gene [Source:MGI Symbol;Acc:MGI:106183]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 134154531..134154576 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3217357..3217402 44
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 104594991..104595036 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032564 (Cpne4) NM_028719 copine IV Gene [Source:MGI (curated);Acc:Cpne4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 134457422..134457467 44
NO GENE  


Sequence tag IST14765F4HMF1
Sequence
ACAGTGGCTCATCGGTGGCAGAGGAGGTGGCAAGAGCGAGTGATTCGAGTACATTCAGAGGAAGCGCCCCCAGCGCTTGC
TGGTGTATCAGGAGTGTGGGTGTTCAGAGAGGGAGGCTTGANAGTGATCCTCANACNTNNGGGTGANTGGAGGAAGCTAC
NNNNNGCTGGGGGANGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032564


For any suggestions or comments, please send an email to unitrap@crg.es