Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14892G3
Clone ID IST14892G3
Vector VICTR76
Project tigm

Sequence tag IST14892G3HMR1
Sequence
CCTCTAGAACTGGAGTGGTGGTTGTGAGCCNAGATGTGGGATATTGGGACTCGAACCTGGGTTCTCTGGAACAGCAGTAA
GTAATCCTAACCNCNGAGTCATCTTTCCNGCCCCCTANAACATTGATTCTCAACCTTCCTAATCCTGCANCCCTTTGTTC
ATGTTGTGGTGACACGCCCCNCCT
Sequence Type genomic DNA
Unitrap ID UNI12015

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 126545879..126546061 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031976 (AK122209) NM_001029876 URB2 ribosome biogenesis 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2681124]

 
Come back to gene ENSMUSG00000031976


For any suggestions or comments, please send an email to unitrap@crg.es