Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST471239
Clone ID OST471239
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST471239
Sequence
TGCACAGGGTAAGATGGCACCTCTGAAGAGCCATGTGCCCTGCACGGAGAAACCAGGAAAGGTCCAGGAGCCTCCAGATG
ATGGCAGTCTGCACTGGTCAGAAGGCTCAAAGGGTGAAGACATAAAGAAGTATAGCCGGGAAGGGACACCTACTGGAGCA
AATACAACCAACAATACCACANGCTGTTTAAAGATATCCCGTTGGAGGAGGTGGTCCTCAAAGTGTGTTCCTGCGCCACA
GTAAAGTGTGTTGGTTTGCTTGGAA
Sequence Type mRNA
Unitrap ID UNI15871

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 59555820..59558322 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074259 (Gramd2) NP_001028670 GRAM domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:3528937]

 
Come back to gene ENSMUSG00000074259


For any suggestions or comments, please send an email to unitrap@crg.es