Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14837H11
Clone ID IST14837H11
Vector VICTR76
Project tigm

Sequence tag IST14837H11HMF1
Sequence
CTAGGATGGTGGCAATTGCAGAGGTGATGACAATGGGGTATCAGAATAAAAAGGAGCCACCTCCACACAGTTTAACACAC
TCAGAAAATTCTGGAATCAAATCTAGTTCTGCCAGCACTAAGCTGTACCAGACAAGCATCCTCTCTGAGGTTCAAATGCT
TTATTTTGTGTGGGAAGAATCTCAGCACTGACTAGAGCTGTACAGATAAAGGGATAGACTATACATAAAATGTTAGTAAA
TTATCAGCACACCAAAATTGCCTCACTGAAAGGGACAAACAGCACTCATGTTCCCAAATTCTATGCCTAGCGCCACTCCC
TTGTTGGCTCCAGTCTCATAACCACTTGCAACCTTTACTAAAGAGTCTAACAGATATTGCANACCAGANCCTCAAACTCT
TATGANGTGCNCNTGCCTAACTCCNNAACATGATTCCTGTCCCANTCNTGCCCAGTTTACTNAAGANCAGANTGNNNGCT
CNNNTCATANANNNNNNNTGGTTNNNANTNNNNNNNNNNNNNNNNNNTNNNNNTGGGGGGACTGNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84166517..84167005 453
 
EST/CDNA Est Name
  AW495310.1 - AW492736.1 - CK344190.1


Sequence tag IST14837H11HMR1
Sequence
NNGAAGTTTCTCCNTAGAAAAGATGCAGCCTTCTTGAGAGGCCGTCTCTTCAAAATTCTCAGTTTTCCTAGATAAATCCG
TTGTTATCTTCCATGAAAGTGAAACGAATGCTACCAAACCTGAATGGGTCCTGAACTGCCCAGAAGGCTCACTCCCCAAC
TCTACTTCCTGATGCGCCTTCTCTACTGAAATTAACTCACTATAAAAGTACCCCCTCTTCCTTCTTTAACTGATCTGCTA
AGGCCTTAGTGCTTGATTAATTAAAATTCAGTCTCACGAAAAAAACAGTAAAATTCATAGCCTTCAATTCTGACCNTTCT
CCTGATTGCCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI9634

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84167005..84167336 328
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034453 (Polr3b) NM_027423 polymerase (RNA) III (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:1917678]


Sequence tag IST14837H11BBF1
Sequence
CTAGGATGGTGGCAATTGCAGAGGTGATGACAATGGGGTATCAGAATAAAAAGGAGCCACCTCCACACAGTTTAACACAC
TCAGAAAATTCTGGAATCAAATCTAGTTCTGCCAGCACTAAGCTGTACCANACAAGCATCCTCTCTGAGGTTCAAATGCT
TTATTTTGTGTGGGAAGAATCTCANCACTGACTAGAGCTGTACAGATAAAGGGATANACTATACATAAAATGTTANTNAA
TTANCAGCNCACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 84166754..84167005 238
NO GENE  

 
Come back to gene ENSMUSG00000034453


For any suggestions or comments, please send an email to unitrap@crg.es