Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST471187
Clone ID OST471187
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST471187
Sequence
GACTGAGGGTTCGCTGATGCCCCAGTNCTGCTTATCTGTGGAAACCTAGAAGGTGGAGAGGGAGGAGACAGTAGCTAAGG
ATCCAGGACTACAAGCTGGCTATTCATCATTCCTGACAGAGAAATTTAAAGAAGAGAAACAAACAAACAAAAA
Sequence Type mRNA
Unitrap ID UNI15876

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 21706011..21710887 70
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000067931 (BC049807) NM_001002008 Putative uncharacterized proteincDNA sequence BC049807 ; [Source:UniProtKB/TrEMBL;Acc:Q6DFU8]

 
Come back to gene ENSMUSG00000067931


For any suggestions or comments, please send an email to unitrap@crg.es