Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13351A6
Clone ID IST13351A6
Vector VICTR74
Project tigm

Sequence tag IST13351A6BBF1
Sequence
GTCATGACACGTGTCTCTGTAGCTCGGTTACGCACGCCATCGTGCGACAGAAATTTTTGATTCACGTGGGTCGGGATCAT
CTTGAACCTGAAGAGAAGCAGGCGTTGAAGCGGCTGGTGGAGGAGGAGCTGCCGAAAATGCAGGTGTGGGTCTAACCCTG
GGCCANCANANACAGGGTTTGTTGCTGAGGGGTTGGGGCAGGGCATCTTGGTTCGGTTTGCCCTCATGCTGCACCCNNAG
GCGGATGCTGGTACNNNGGAAGGAAAGCCNNACTTTNNCN
Sequence Type genomic DNA
Unitrap ID UNI35529

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134006092..134006367 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042606 (Hirip3) NM_172746 HIRA interacting protein 3 Gene [Source:MGI (curated);Acc:Hirip3-001]

 
Come back to gene ENSMUSG00000042606


For any suggestions or comments, please send an email to unitrap@crg.es