Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10908D2
Clone ID IST10908D2
Vector VICTR76
Project tigm

Sequence tag IST10908D2HMF1
Sequence
GATGACACTCTGCAGCCCCAATCCAGTCCTGATCACTTTGGACACCTCTTGGGGACCTGGGGGCAGATTCCAGGAGCTTT
CANAGGGAGCCTGTNGGGCTAGCAAAACACGGCAGGGGGAGCTGCCACCCACAGCGGAACATGCACTCCAATGAAGGAGG
AGAGACAGCCATGACCCAGCCCCAGTGGTGTCACAACATAGGAACCTTTTCAGTTCTACANANCTNATGGTGGA

Sequence Type genomic DNA
Unitrap ID UNI15420

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 130355911..130356143 223
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030766 (Arhgap17) NP_001116115 Rho GTPase activating protein 17 Gene [Source:MGI Symbol;Acc:MGI:1917747]

 
Come back to gene ENSMUSG00000030766


For any suggestions or comments, please send an email to unitrap@crg.es