Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14280C12
Clone ID IST14280C12
Vector VICTR74
Project tigm

Sequence tag IST14280C12HMR1
Sequence
NNGAGGACAANATCACAAATGGACGTGATCCCCGTGTCTGGATTCTTCTCCCCCTCCCCCCCTCCTGTCGCCATTTGCTG
TGGTTGCAGGGGAAAGTGTTTTGTGTGGTTTTCGTTTTATTGCTGTCGTTTACTTCTCCGGGCGTCTTGGGTCCTTGANA
ATCTTGANATAAACGACGCGGAANACCTTGANCTCTGTACAGGTTTGAGGTTCCNAN
Sequence Type genomic DNA
Unitrap ID UNI15165

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 138526623..138526834 202
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029729 (Zkscan1) NM_133906 zinc finger with KRAB and SCAN domains 1 Gene [Source:MGI (curated);Acc:Zkscan1-001]

 
Come back to gene ENSMUSG00000029729


For any suggestions or comments, please send an email to unitrap@crg.es