Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13019G10
Clone ID IST13019G10
Vector VICTR76
Project tigm

Sequence tag IST13019G10HMR1
Sequence
NNCTATCATTGTGAAGCAGAANTCACCAAGCGTTGGATTGTTCACCCNCTANTAGGGAACGTGAGCTGGGTTTAGACCGT
CGTGAGACAGGTTAGTTTTACCCTACTGATGATGTGTTGTTGCCATGGTAATCCTGCTCAGTACGAGAGGAACCGCAGG
Sequence Type genomic DNA
Unitrap ID UNI31651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 123371150..123371305 148
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035202 (Lars2) NM_153168 leucyl-tRNA synthetase, mitochondrial Gene [Source:MGI Symbol;Acc:MGI:2142973]

 
Come back to gene ENSMUSG00000035202


For any suggestions or comments, please send an email to unitrap@crg.es