Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12733E8
Clone ID IST12733E8
Vector VICTR76
Project tigm

Sequence tag IST12733E8HMF1
Sequence
AAAAATAATTCGCGTCTGGCCTTCCTGTANCCNGCTTTCATANNACACCCTCTTCTGGAGTGTCTGAAGACAGCTACAGT
GTACTTACATATAATAATAAATAAATCTTTA
Sequence Type genomic DNA
Unitrap ID UNI15887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 20041023..20041089 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 130199911..130199977 67
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66383900..66383966 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054598 (9130230L23Rik) RIKEN cDNA 9130230L23 gene Gene [Source:MGI Symbol;Acc:MGI:3041166]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 120425455..120425521 67
NO GENE  

 
Come back to gene ENSMUSG00000054598


For any suggestions or comments, please send an email to unitrap@crg.es