Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14026B4
Clone ID IST14026B4
Vector VICTR74
Project tigm

Sequence tag IST14026B4BBF1
Sequence
CCACCATGTGGTTGCTGGGATTTGAACTTCAGACCTTCGGAAGAGCAGTCGGGTGCTCTTACTGAGCCATCTCACCAGCC
CCCAAAGAGCCTTTTATTTCCTCCGCCATACCTCTTCGAAGCCCAGAGGACAGTGAGACACTAGCCAGGGTGAATAGTCA
GCTTCTCTGCTGCCTCCTTGAAGACCAAAAGATGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154256013..154256210 198
NO GENE  


Sequence tag IST14026B4HMF2
Sequence
CCACCATGTGGTTGCTGGGATTTGAACTTCANACCTTCGGAAGAGCAGTCNGGTGCNCNNAA
Sequence Type genomic DNA
Unitrap ID UNI10057 UNI25758 UNI31738 UNI34357 UNI35534 UNI35535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166364: 152206..152261 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166390: 237371..237426 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161875: 123609..123664 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161902: 798508..798563 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 3737217..3737272 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12322183..12322238 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 17042807..17042862 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16849895..16849950 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 47694388..47694443 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 65263820..65263875 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 41305987..41306042 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035954 (Dock4) NM_172803 dedicator of cytokinesis 4 Gene [Source:MGI Symbol;Acc:MGI:1918006]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20122040..20122095 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020149 (Rab1) NM_008996 RAB1, member RAS oncogene family Gene [Source:MGI (curated);Acc:Rab1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7700048..7700103 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 49063264..49063319 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 7465370..7465425 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000019794 (Katna1) NM_011835 katanin p60 (ATPase-containing) subunit A1 Gene [Source:MGI Symbol;Acc:MGI:1344353]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73103655..73103710 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000070002 (Ell) NM_007924 elongation factor RNA polymerase II Gene [Source:MGI Symbol;Acc:MGI:109377]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 38323572..38323627 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 4887460..4887515 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035279 (A430110N23Rik) NM_173008 RIKEN cDNA A430110N23 gene Gene [Source:MGI Symbol;Acc:MGI:3606211]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 20315834..20315889 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 59014011..59014066 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 61293093..61293148 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 20763659..20763714 52
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 22781817..22781872 52
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026784 (Pdss1) NM_019501 prenyl (solanesyl) diphosphate synthase, subunit 1 Gene [Source:MGI Symbol;Acc:MGI:1889278]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 41851662..41851717 52
NO GENE  

 
Come back to gene ENSMUSG00000026784


For any suggestions or comments, please send an email to unitrap@crg.es