Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12139C8
Clone ID IST12139C8
Vector VICTR76
Project tigm

Sequence tag IST12139C8BBF1
Sequence
ATTGGCTGCACACGTAGGAAAGTCAGAAGGGTGCTGCCTACTCGGCAAACAGGCTTCTTTAGGGGTCATGCTGGGTCAAA
AAGGGCACCCTGCTCTGACCCTAGGATTTGTTTCTTAGCTAGGGAAGAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI33700

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 75468837..75468969 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017774 (Myo1c) NM_001080775 myosin IC Gene [Source:MGI (curated);Acc:Myo1c-002]

 
Come back to gene ENSMUSG00000017774


For any suggestions or comments, please send an email to unitrap@crg.es