Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14938D11
Clone ID IST14938D11
Vector VICTR76
Project tigm

Sequence tag IST14938D11HMF1
Sequence
NGANGTGCCNANCANGGTTCTAACAGGAAGCANCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCNNGG
CCTCANNAANGTCANTTCCCGCCGGGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14938D11HMR1
Sequence
ATCTGCCTAGCATGGACAAGTTCAGAGTTGCTTCTATACCCAGGGCAGCCAGGGTCTGATGTATGTCAGTCAGGCCAGCC
AAGGGACTAGCCAGCCCCGCTTCCCTGTAGCTCTCTCACTCTGGAGCTCTAGTCTTCAGAGGAGCGAGGTGCTCACTAAN
CTGTANACCTTCGCCTCANAGGANATGGCNNCTCTTCTCTTCATTCTCCTTGGCTTCTTGTAACCCGAANCTTGCTCANN
ATCTGGAATTTCCAGGTGTTTCTCTGGGTGATCTGGATCTAANAGGATACCNNGGAATGTGGCCN
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634621..165634924 280
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]


Sequence tag IST14938D11BBF1
Sequence
AGATGTGCCTAGCAGGGTTCTAACAGGAAGCAGCTGCAGGGTGGCTTGTGCTGCTGCCGGTGACACAAATGTCATCAGGG
CCTCAAGAAGGTCAGTTCCCGCCGGGCAGTGGTGGTGCATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGGAGGAT
TTCTGAGTTTGAGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACAGCCNGGGCTACACANAAAAACCCTGTCTCGAAAA
AN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165634921..165635161 235
 
EST/CDNA Est Name
  CK622678.1 - AW762466.1 - W49202.1

 
Come back to gene CK622678.1 - AW762466.1 - W49202.1


For any suggestions or comments, please send an email to unitrap@crg.es