Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10894C1
Clone ID IST10894C1
Vector VICTR76
Project tigm

Sequence tag IST10894C1BBF1
Sequence
GCTATAACTGCACAAACCTGGTAGCATGANTTTGATCCTCTGGTCCTGTGTAAATGGGAAGAACCAACTCTACCAAGCTG
TCCTCTGACTTCCACATGGCACANTCACTCACACAAATTCTTTAAAAANAACAAATCTTGNGGTTGGAGAGATGGCTCAN
CAGTTAANAGCACTGGCTGATCTTCCTTCCANANGTTTTCCAGAGGTTTCAATTCCCAGCAACCACATGGTGGCTCACAA
CAATCTGTAATGGGATCTGATGCCCTCTTCCAATACAAATGANNACAGCGTACTCATATACATAAAATACATNNNTAAAT
AAATCTTAAAAAAAAAAAAAA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32772478..32772817 314
 
EST/CDNA Est Name
  CA567884.1 - BG873590.1 - BQ942127.1


Sequence tag IST10894C1HMR1
Sequence
NAGCCTTTACCTCCGAGCCATGCTAGCTTCAAAAGGTATAGTCTAATATGCCATGTGTAATTTCCATGATATAAAANGGG
CCNTANTTTGTTTACTCCCTTATTTGAGTGATGGATATCTCTTCTCAA
Sequence Type genomic DNA
Unitrap ID UNI35539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32772354..32772480 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013662 (Atad1) NM_026487 ATPase family, AAA domain containing 1 Gene [Source:MGI Symbol;Acc:MGI:1915229]


Sequence tag IST10894C1HMF1
Sequence
GCTATAACTGCACAAACCTGGTAGCATGANTTTGATCCTCTGGTCCTGTGTAAATGGGAAGAACCAACTCTACCAAGCTG
TCCTCTGACTTCCACATGGCACAGTCACTCACACAAATTCTTTAAAAAGAACAAATCTTGGGGTTGGAGAGATGGCTCAN
CANTTAAGAGCACTGGCTGATCTTCCTTCCAGAGGTTTTCCAGAGGTTTCAATTCCCAGCAACCACNTGGTGGCTCACAA
CAATCTGTAATGGGATCTGATGCCCTCTTCCAATACAAATGAAGACAGCGTACTCATATACATAAAATACATGANTAAAT
AAATCTTAAAAAANAANAN

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 32772478..32772813 324
 
EST/CDNA Est Name
  CA567884.1 - BG873590.1 - BQ942127.1

 
Come back to gene CA567884.1 - BG873590.1 - BQ942127.1


For any suggestions or comments, please send an email to unitrap@crg.es