Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10956C5
Clone ID IST10956C5
Vector VICTR76
Project tigm

Sequence tag IST10956C5BBF1
Sequence
ACCCTGTCTNAAAAAACAAAACAAAACAAAATCCATTTTTTATTACTTTTCATCCAGTTCCTCTANAATCTGTTAATGTT
TCCTTTTTAAGAAGAAATTTGTGTGTGTTTGTGTATCTGTGAGAATCTGCCACGTGCACCCTCACAGTTCAGAGCGGGGG
TTATTAAGTCTCCTGGAGCTGGAATTACAAGCTGTTGTGAACCAACCATGTGGGTGCTAGGAACCGCTGANCTATCTTTC
CAGCCTCCTGTTAATGTTTCTTGTATAAAGTGANCTTAATCCCANCCCGGTCTACATAGCAAATTTCNNGGATGTCCAGG
CCTACATAGACAGATCTG

Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95081480..95081816 323
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]


Sequence tag IST10956C5HMF1
Sequence
ACCCTGTCTNAAAAAACAAAACAAAACAAAATCCATTTTTTATTACTTTTCATCCAGTTCCTCTAGAATCTGTTAATGTT
TCCTTTTTAAGAAGAAATTTGTGTGTGTTTGTGTATCTGTGAGAATCTGCCACGTGCACCCTCACAGTTCANAGCGGGGG
TTATTAAGTCTCCTGGAGCTGGAATTACAAGCTGTTGTGAACCAACCATGTGGGTGCTAGGAACCGCTGAGCTATCTTTC
CAGCCTCCTGTTAATGTTTCTTGTATAAAGTGAGCTTAANCCCANCCCGGTCTACATAGCAAATTTCCAGGATGTCCAGG
CCTACATANACAGATCTTGTTTCANACAAACAAGAGCTTGTTTGGAGCTTCCAGCAGANGAGTACAGAGACATGTGCACT
CTGACNAGAGTGCAGTCTTCTGATAGAGGTTGTCCTCNNNNNGANGAATGTANNTAGGGCAGTGANGGGAAAGTTGGNNC
CTGGA
Sequence Type genomic DNA
Unitrap ID UNI4828

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95081333..95081816 446
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015711 (Prune) NM_173347 prune homolog (Drosophila) Gene [Source:MGI (curated);Acc:Prune-001]

 
Come back to gene ENSMUSG00000015711


For any suggestions or comments, please send an email to unitrap@crg.es