Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0470
Clone ID AC0470
Vector pGT0lxr
Project sanger

Sequence tag AC0470
Sequence
CCGGTCCGGATCCCCCTCCTAGATTCGTCTACGACATACGTATACTTCCTGTCGCGATCTCCTCCGTTCACCCTCTTTCC
CCGGCCCCCTAAAACTTGAGCCGAGAGGGTCATAGGTATGGCGGCCTTTAGGCTCCCCATATATACTGCACCACCCCTCC
ATTCTAAATATGTTGAAGAACAGCCTGGTAATTTACAAAGGGGCTTTGCATCCATCCGTACTACAACCGTGTATTATATT
GGCTGGTGCAAGAGCATTTATCTCTTTATGAAGAATGGGGTTATGGATACAGTACAGTTTGGAAAAGATGCATATGTCTA
TCTGAAGAATCCTCCGCAAGATTTTCTCCCCAAAATGGGAGTGATTACAGCTTCGGGACTGGCAGGTTTGCTTTCAGCAA
GAAAAGGTTCCAGGTTTAAGAAGATTGCTTATCCACTAGGACTGGCCACATTAGGAGCGACTGTTTGCTACCCAGCTCAG
TCAGTAATAATTGCAAAG
Sequence Type mRNA
Unitrap ID UNI2960

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 109424975..109467861 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025525 (Apool) NM_026565 apolipoprotein O-like Gene [Source:MGI (curated);Acc:Apool-003]

 
Come back to gene ENSMUSG00000025525


For any suggestions or comments, please send an email to unitrap@crg.es