Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12231F3
Clone ID IST12231F3
Vector VICTR76
Project tigm

Sequence tag IST12231F3HMF1
Sequence
CGGCTTCGTCTTCAGCCGAGGAGTGAATACAGGGAGGAGCCAGTGAGTCCCCCAGGACCCACCAGCCACAAGCCACGCAT
CAAACCGTCCCTCCTCCATCCCTCTGTCCCATTCTGCCTCGGCATTCCTCAGCCCCTGAACTTCCCTGAGGGAGCCCTGA
CATCTACCAGGCTCAAGCTCCTGGAAGCCTTTCCCAGCACCCTGGGTTCAAAGCCAGAAAGCCAAGCTACATTCTCCTCC
CAGTTGGCACCAGTTA
Sequence Type genomic DNA
Unitrap ID UNI19739

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 21573166..21573420 255
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032194 (Kank2) NM_145611 KN motif and ankyrin repeat domains 2 Gene [Source:MGI Symbol;Acc:MGI:2384568]


Sequence tag IST12231F3BBF1
Sequence
CGGCTTCGTCTTCNNCCGAGGAGTGAATACNGGGAGGAGCCAGTGAGTCCCCCAGGACCCACCAGCCACAANCCACNCAT
CAAACCGTCCCTCCTCCATCCCTCTGTCCCATTCTGCCTCGGCATTCCTNANCCCCTGAACTTCCCTGAGGGAGCCCTGA
CATCTACCAGGCTCAAGCTCCTGGAAGCCTTTCCCANCACCCTGGGTTCAAAGCCNGAAAGCCAAGCTACATTCTCCTCC
CAGTTGGCACCNNTTGACAACGCCTTGGGTGTGGGTTTCTTGTAAAGAACATANAGAACAATCNNCCGGCNATTATGGGA
GGAGGAAGGGGGGGCAAGAAGAGAAAATACTGTATTCTTGANTCNTTGTTANGGGATGGGAGGGGTCAGAATTCAGTTGC
TAAATTTGAATGTCACTGGAATGTTACAGTGTCTATTGTCTCCTCATCTTTACNGCAGGTCTCCACAAAGCCTGCTCACC
ACCCTTTGTCACCTCATTTCATTGTCTAGTGTACAANNNGGTCTTGTCCACTGCCCTCCNCCTCCAGANTGNGTCTTCNG
GGNCTGGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032194


For any suggestions or comments, please send an email to unitrap@crg.es