Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST470938
Clone ID OST470938
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST470938
Sequence
TTTGAGGCACCCCAGGAACCATTTTGCTGTTACTNCTGGTTGATTGATCCCAGAGCTGATGGTNAGGCCCATGACTGGAC
TTCTTGTACCATACATGAACCCAGAGAAGACTTCTGCTTCTCACTCAAAGTTGTATCTACTGTGGGAGGGTCTCACGATG
TAGTCCAGACTGACCTCCGGCTTACGAAGCTCCTGCCTCCACTTCCGGNGTGTTGCAATTACAGCNTTNTCACCTCGCAG
ACCTGCTGCGT
Sequence Type mRNA
Unitrap ID UNI15887

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 66381077..66381660 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054598 (9130230L23Rik) RIKEN cDNA 9130230L23 gene Gene [Source:MGI Symbol;Acc:MGI:3041166]

 
Come back to gene ENSMUSG00000054598


For any suggestions or comments, please send an email to unitrap@crg.es