Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15057H3
Clone ID IST15057H3
Vector VICTR80
Project tigm

Sequence tag IST15057H3HMF1
Sequence
GGAGGAAAGCTGAAATTTTAAACCCTAGGACTTAGAGGTCACAGCTTCCAAGAGTCTCCAGAATCCTCTCACCTAAGGTT
TTCCCCTCTGAAAACTGGGAGGATCTTCCCCACCTCACAGAGCTGCTGCCTAGGGGACATGAGATTATGGGCTTGCATCT
TTCAGAAATTTGAAGTGTTGAGCTATTTACAAATGTCAGTTTAACACCTGGCTCCCTCCAAGATGCTCTGAAGCAGATCT
CAAGGATATAGGTCTAGAGGAGGGGATGGGCTAAGGTCATCCAGACCCTGTGAATTCTTTTTTCNTTANTCATTCNTTTT
AAGATTTANGTTTTANATTTTTAAAAATGTNNNNNNTNNGCTTTTGGGAGACNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163490633..163491004 346
NO GENE  


Sequence tag IST15057H3BBF1
Sequence
GGAGGAAAGCTGAAATTTTAAACCCTAGGACTTAGAGGTCACAGCTTCCAAGAGTCTCCAGAATCCTCTCACCTAAGGTT
TTCCCCTCTGAAAACTGGGAGGATCTTCCCCACCTCACAGAGCTGCTGCCTAGGGGACATGAGATTATGGGCTTGCATCT
TTCAGAAATTTGAAGTGTTGAGCTATTTACAAATGTCAGTTTAACACCTGGCTCCCTCCAAGATGCTCTGAAGCAGATCT
G
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163490765..163491004 240
NO GENE  


Sequence tag IST15057H3HMR1
Sequence
CTCCTATGCCTTTCTATATTTTTCTTCTCCCTTCCTCCCTCCCGTTCACCTTTCCTTCTCAACTGGAGATTGAAGGAGCC
CAGGGCTAGGCAATGATAGAATGCTGAGTAATAAATCCCTCAGCCCTAGCCCAATGCTGCTTTTGAGACAATCTCTAGCC
CTGGCCGGTAGTGAATTCCCACTAAGTAGGGGGAAATGTCCTTGAACTTCTGAACCTAGAGGGATGCTCCACCACGCACA
GGTTTCTGTAGTGCTGCGACTCACACTCAGGGCTTCCTGCATGCTAGGCAAGCACTCTACCAATTGAGCCACACCCTGAG
CCCCTATTCTTCAAGTACTTTTTTGGAGAGATTGCAAATACCTTTTANAAAAAGGTACCTTGGCATTACAGTGATCTTGT
CTTGCTTCATTTGATGGTTACAGCTTTTCCCCAAGCTGCCCAGCTTTTCTGTTCACAATGATTCACTCTGGGAGAANNTG
NTCNNNATGGCAGCATCCATGATTCTGTGTTCTACAGN
Sequence Type genomic DNA
Unitrap ID UNI30552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 163491001..163491518 500
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035268 (Pkig) NM_001039390 protein kinase inhibitor, gamma Gene [Source:MGI (curated);Acc:Pkig-001]

 
Come back to gene ENSMUSG00000035268


For any suggestions or comments, please send an email to unitrap@crg.es