Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12079B3
Clone ID IST12079B3
Vector VICTR76
Project tigm

Sequence tag IST12079B3HMF2
Sequence
CTGTGAGTGATTTTCTGAGGCAGGGGGCTGACTGTGAGTGAATTTCTGAGGCAGGGGGATGACTGTGAGTGAATTTCTGA
GGCAGGGGGATGACTGCGAGTGATTTTCTGAGGCAGGGGGATGACTGTGGGTGAATATATGAGGCTGGGGGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 166440946..166441098 153
NO GENE  


Sequence tag IST12079B3BBF1
Sequence
CCATGCCTTGCTTCTTTCATTCTTAAACCGAGTCTATATGTATCTCAGGCTGGCTATGAACTCACAGAAATCTATCCTTG
TCTTTTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI10886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 88376676..88376771 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005370 (Msh6) NM_010830 mutS homolog 6 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1343961]

 
Come back to gene ENSMUSG00000005370


For any suggestions or comments, please send an email to unitrap@crg.es