Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11593E2
Clone ID IST11593E2
Vector VICTR76
Project tigm

Sequence tag IST11593E2HMR1
Sequence
GGACCTGCCCTGGGGCCTGCAGCCCGTGTAGCCACCAGGACCCGACCCGGTGCCTGAACCCTGACATCCTAGCTGAAACC
CTCTCCTGGGCCTCGATCGCACAACCCAGCAGAAGCCAGCTCCCGATTCTTGATTCCAGACCCCCAGCCAGCTCTTACCC
CTGGGTCTTGTTTCTTTACCNNATCTCCCCAGGCCTGCACCCCACGCCCGGGATCCAAACCCTGAATCTTGTCCAAATGA
TCCTACACCCGACCCCCGATCCAGGCCACTTCCNNTN
Sequence Type genomic DNA
Unitrap ID UNI9402

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 125736101..125736373 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000743 (Chmp1a) NM_145606 chromatin modifying protein 1A Gene [Source:MGI Symbol;Acc:MGI:1920159]

 
Come back to gene ENSMUSG00000000743


For any suggestions or comments, please send an email to unitrap@crg.es