Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15052F9
Clone ID IST15052F9
Vector VICTR80
Project tigm

Sequence tag IST15052F9BBF1
Sequence
CAACAAAAACCTGTCTCCATCCCCCTTAGGAGCTATTGTTATAGGCATTTGTTGGGGACACCCGGCCAATTACACACTGT
TGCTGGAGTCAGTGATTTGTCCCCACTGAGCCATCTGACCAGACCAATCTGTGCTTTTGCTTTTATCTGCCAAAATTCTC
TCTCCTTAGAGAACCAACACTCTAGAGAGAAGTAGTGTTTCCAAAATTGCCACCCAGTGTGAACTTGTGAAATTTGCATA
CCAAGCCTGAGCACTTAGGCATGCTGGTGAATTTCCTTTGCAGTATATTCCCAATACATCTCGGGAGGCCAGAATGAAGC
AGGGTCCCAAGAAATCNAAGATAGTCTTCAGANGAATCGGGCCTCCNAGCGGGTGCCAAAGGAAAAANGANGAGAGTGGT
GTCCTGNAAATTCTAACTTCNCCTAN
Sequence Type genomic DNA
Unitrap ID UNI20995

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48315492..48315916 411
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072419 (Dppa2) NM_028615 developmental pluripotency associated 2 Gene [Source:MGI Symbol;Acc:MGI:2157523]

 
Come back to gene ENSMUSG00000072419


For any suggestions or comments, please send an email to unitrap@crg.es