Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12312H7
Clone ID IST12312H7
Vector VICTR76
Project tigm

Sequence tag IST12312H7HMF2
Sequence
CCAGGACCCTGGAGCCCACAGACTCCAGGCCTGGGTCAAGCGTGATACCTCGCTCCAGACTGATGGCACTGCCAGGTCCG
TGTTAGGGGAAATGAAACCTCCTTAGCGGGTGGGGCTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 122859470..122859588 119
NO GENE  


Sequence tag IST12312H7BBF1
Sequence
TTTTAAAGTCAAAGAACTACTTTTGAGAACTATTTTCTGCCACCTAATGAGTTTTGGGGAACAAGTTTAGGTCATCAGAT
CTG
Sequence Type genomic DNA
Unitrap ID UNI28081

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39036543..39036623 81
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es