Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13017A3
Clone ID IST13017A3
Vector VICTR76
Project tigm

Sequence tag IST13017A3BBF2
Sequence
NGGNNNNTTGNNNGNNGACCTCCNCATGCATGCTGTGACCTANNTATGCACACATACNGACNNNNCNTATAAAAAAAGGT
CNAAAACATAAAGCCCTTAATTAAACGTTCCACCCTCCGCTCCTTTCCCTTCTGGTGAAGTCCATCANTACAAGCCGGGC
ACACTGCCCTTCCTTCCTTCCTTCCCATCAAGGCCCCTGGTGCGCTCCCGGAATCTTCCCTCACCCCACTGCTTCCTTCN
NGNNNNNNNNNNNCTTTTGNCNNATCNNACCNATTCTGCTTCCCAAATATATCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13017A3HMR1
Sequence
GCAGGAGTCAGTAGGTCCTAGAAGCCNAACTCAACTTGCCAAGTGCCTTCACCCACTGTGTGAACCCATCTCACAGGCCC
AANATTTTATCTTGAAAAAAAATTTTTTTTTGTTTTTCCTCCTGAAGTTCTAATANACAGAN
Sequence Type genomic DNA
Unitrap ID UNI30139

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 154441333..154441473 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059842 (Zfp341) NM_199304 zinc finger protein 341 Gene [Source:MGI (curated);Acc:Zfp341-001]

 
Come back to gene ENSMUSG00000059842


For any suggestions or comments, please send an email to unitrap@crg.es