Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14888C3
Clone ID IST14888C3
Vector VICTR76
Project tigm

Sequence tag IST14888C3BBF1
Sequence
CTACTGTGAGCCCTGTGTGTGTGTCCGCAAAGTAGGAGGAGGGAGAAGGAAAGAAGGAGGAGGGGATGTTTTCTTAACAA
AACTCTTCCTTTTAAAGAACCATCATTTCTATAATGAGCCCAAGCAATGGCTCTGTATGAGATTCTTTTATCAATAGCTT
TGACTTCAAAGTGTCCCCTTCTTTTTCTCTGANACAGGTCTTGCNNTGTAGCCTAGGTGANCCTCANNCCCCGACCNNCT
GCCTTGGCCTCCNGACTGCNGGAATTGCANACNANNNCNCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14888C3HMR1
Sequence
AGTAGGAATTCAGTGCATACTGCATCTTTAAACTTTGAATATTCTGACACTATTTTACTCTTTTAGAATAATTATAGTAA
TACAATTCTGTGCTTACATACCAGAATATCCATCATGAGACTAGGGCAAGGCTCAAGACGTAAAGCCTGTTATTAACTGT
GCAGTCTATTTTTAATTTTCAAGCGCCTTTGGCTCCCATGAACATAATTTGGGGAGTTTGGTNTGGTGGAAAGAAAACNN
ACN
Sequence Type genomic DNA
Unitrap ID UNI29946

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33008332..33008569 236
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040183 (Ankrd6) NM_001012450 ankyrin repeat domain 6 Gene [Source:MGI (curated);Acc:Ankrd6-002]

 
Come back to gene ENSMUSG00000040183


For any suggestions or comments, please send an email to unitrap@crg.es