Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST470465
Clone ID OST470465
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST470465
Sequence
GAGATCTTCCTAAGAAGACAGTGTCACTGTGGTCCTATATAAACAGCCAGCTGGAAGACTTTACTAATCCTCTTTATGGA
AGCTACTCCAATCATGTCCTTTACCCAGTAGCCAGCATGCGCCACCTAGAGCTCTGGGTGGGATATTATATAAGGTGGAA
CCCCCGGATGAAACCTCAGGAACCTATCCACAGCAGATACAAAGAACTTCTTGCCAAAAGAGCAGAGCTTCAAAGAAAAG
TAGAGGAACTTCAGAGAGAAATTTCCAACCGCTCAACCTCCTCTTCAGAGAGAGCCAGCTCTCCTGCACAGTGTGTGACT
CCTGTCCAAACTGTTGTATGAAAGGACTAGGCCCAGGGCCTCATTGCCAGGAACCTGACATTCCAGCACCTTATGGGTAG
AAAACCTTCCGTGTTTAAAACCCATCTACTGGAGAATCCTTCGGATGCTGTATTTATTTCAAATCTCTCTTAGATGAGTT
TAGAAACATAGCAG
Sequence Type mRNA
Unitrap ID UNI15905

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 13609251..13610133 318
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031918 (Mtmr2) NP_076347 myotubularin related protein 2 Gene [Source:MGI Symbol;Acc:MGI:1924366]

 
Come back to gene ENSMUSG00000031918


For any suggestions or comments, please send an email to unitrap@crg.es