Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST470442
Clone ID OST470442
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST470442
Sequence
GGAGTCAGATGGCAGCACTATGGAGGACTATTCACAGGAGGACTGGGGAAACCACAGTCAGGAGCTCCATGGCTATCCAA
CAGATCAGGAATTGGATGAAATGCCAGTTTCAAAGAGAACGTTAAAAATAAAACAA
Sequence Type mRNA
Unitrap ID UNI15908

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 37324963..37326352 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042138 (BC024479) NM_146222 Uncharacterized protein C11orf61 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NZR2]

 
Come back to gene ENSMUSG00000042138


For any suggestions or comments, please send an email to unitrap@crg.es