Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13089A9
Clone ID IST13089A9
Vector VICTR76
Project tigm

Sequence tag IST13089A9BBF1
Sequence
CTGAGAATGGGGCTCTCATGAGTATTTCGATCTCTCAGANAGCACTCCTGGCCACTTAATAGACCAGTTGCAGCTGGGTT
TTCAGATGTGGATTGGATCT
Sequence Type genomic DNA
Unitrap ID UNI16134

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 84778751..84778849 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053062 (Jam2) NM_023844 junction adhesion molecule 2 Gene [Source:MGI (curated);Acc:Jam2-001]


Sequence tag IST13089A9HMF2
Sequence
GTACGATTGCATATACCTTGCTAAAGTGACAATCAAATAGTATCATGTGACTAGAAACAGACCTGAGAAGGACCTGAGAA
GAACCTGGTAAAGCTAGCTCAGTGCTGTTTGCTGGGAGAGGCAAACGTGCCCTTTTCCACACTGTTCTCAGCATCTCCAT
CCATGTATAGGCCAAAAGAGAAAGAAGAGCGAGGCAGTTGAGGCTTCCTTGCTATGGTTTGAGTGTGACACCCCCAGACT
TATGTGTTAGAGCCTGCATCCTCAATTTCATCCACTAATGGTACTAACGGGATGGAATGATGTCATAAAGGTGTGGCCCC
TATAAAGGAAGAAATTAGCACTTAGAATGGCAGGTCTCTGANTGCTCTCACTGCGCAGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 76322575..76322952 376
 
EST/CDNA Est Name
  CJ101337.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1

 
Come back to gene CJ101337.1 - BB611186.1 - AW990482.1 - AW047215.1 - CJ110211.1 - CJ111230.1 - CJ120900.1 - CJ114260.1 - CJ118209.1 - CJ107954.1 - CJ111885.1 - CJ121274.1 - CJ117196.1 - CJ128064.1


For any suggestions or comments, please send an email to unitrap@crg.es