Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14711C4
Clone ID IST14711C4
Vector VICTR76
Project tigm

Sequence tag IST14711C4HMF1
Sequence
ATTTCTTCCCTTTGGAAGGTTCCCCCCTCAGGCCGTAGCGACTGCNTATGGCCTGGAACCNNTTATCACAACTGAAAAGT
ATCTTTAGTCCAACTGCTCGGGGTCAGGAGTGTGTCTGATTTCTAGGTATTGACACATACATCAGGTAGGGGACTCCATT
CTAAATACAACTCACGTATACTTAAAATATACATTAGCTACATAACCAGACGGTTAACG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11708257..11708474 212
 
EST/CDNA Est Name
  BY069677.1 - CN677248.1 - CN691857.1 - CF903923.1 - BB656516.1


Sequence tag IST14711C4HMR1
Sequence
TTCNNGGGACCCTATAATGCAACAACCTGTCAGCTAAATAATGGTGCACGCTGTTTCTCCCCAGGTGACGACATAGCTTA
AGAGATATTCTCAGAGTCACTGCTGAAAGAACC
Sequence Type genomic DNA
Unitrap ID UNI29864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 11708116..11708227 108
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035455 (Fignl1) NM_021891 fidgetin-like 1 Gene [Source:MGI (curated);Acc:Fignl1-001]

 
Come back to gene ENSMUSG00000035455


For any suggestions or comments, please send an email to unitrap@crg.es