Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13764F4
Clone ID IST13764F4
Vector VICTR74
Project tigm

Sequence tag IST13764F4BBF1
Sequence
AGATAACCGTGGTGAATGCAGTATCANTGTGGTTCTTGCCCCACTTGACATTTGTATTGCCCGAGGAAGGAAGACGGTAG
CATAACACTTGGAAAAATGGGCTGAAAACTTANAAAGAGAAATGACTTCTGTCTGGTGCCACATTGCANATAGACCCACA
GACATTGTAGGTGTAGCATCTGTGACTTGAATGGACACTTCAGAGAATAACATGGGTTTGGGACATTCTTTAAATTATAT
TTCCTGTAGGGAGGTGGGGGTGGTGGTGGTGANCNGNTTN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50145331..50145609 267
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]


Sequence tag IST13764F4HMF1
Sequence
AGATAACCGTGGTGAATGCAGTATCAGTGTGGTTCTTGCCCCACTTGACATTTGTATTGCCCGAGGAAGGAAGACGGTAG
CATAACACTTGGAAAAATGGGCTGAAAACTTAGAAAGAGAAATGACTTCTGTCTGGTGCCACATTGCAGATAGACCCACA
GACATTGTAGGTGTAGCATCTGTGACTTGAATGGACACTTCANAGAATAACATGGGTTTGGGACATTCTTTAAATTATAT
TTCCTGTAGGGAGGTGGGGGTGGTGGTGN
Sequence Type genomic DNA
Unitrap ID UNI16635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 50145331..50145598 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073207 (6330534C20Rik) NM_001034059 RIKEN cDNA 6330534C20 gene Gene [Source:MGI Symbol;Acc:MGI:3588225]

 
Come back to gene ENSMUSG00000073207


For any suggestions or comments, please send an email to unitrap@crg.es