Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10053H9
Clone ID IST10053H9
Vector VICTR75
Project tigm

Sequence tag IST10053H9HMF1
Sequence
AGGGGATCTGACACTCTTCTTAAACAAACAAAAAAATCCACAGAGCAAATCAAGCGACCTGCTGAGCAGTACAAATTAGT
CTCCTGTTTGTCACACAGGATGAAATTCTTTCCAATGTTCTAATGTACTTTAAAAGTTCAGAAACATCACAGTGGGATGC
TAACGGAGAACCAACAGCCTTACCTGTCCCATACACACCCAGGGAAGTAACTCAAAAGGTCTATGACCATACTCCAAATT
ACCAAGTGGGTGGAAAGTCAAGTCCTTCCAAAAGGACGCCAGGGTGGCAGGCCCTTACCTACTAAACAACACTAGCAGGA
GAGCTGTGTGCAGGAGGGTCAGATAACTCCAGCCCCTCTGACTTGTCATTCTTGAGCCATCCTCCCAAGTTCCAGCCTGT
AGCACTTAAACCCATACTGTTCCCACCGCAAGGGCTAAGTCACATCAGGGCCGGGAGCACGTCCACTTCTTTACATTACT
ATATCCTCAGTACCCTAAGCATATAGCAAATGAACGCCCGAGCTATGAATTAATGATTCTGCAAGCTCTCTCTTCTCATC
AGCTGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32973758..32974323 566
NO GENE  


Sequence tag IST10053H9BBR1
Sequence
CCTTACAAGCCATTGTGAGTCACCTGATGTGGGCCCTAAGAACTGAACTCTGGCCCTTTGATAACCACTGGGCCATCTCT
CCAGCCTGGTTTGTTTAGTTTGCTTGAGACTGGCTGCAGGGATCCG
Sequence Type genomic DNA
Unitrap ID UNI10778

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 32974321..32974445 125
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056234 (AC154532.3-202) NP_001029160 nuclear receptor coactivator 4 [Source:RefSeq peptide;Acc:NP_001029160]

 
Come back to gene ENSMUSG00000056234


For any suggestions or comments, please send an email to unitrap@crg.es