Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13247A4
Clone ID IST13247A4
Vector VICTR74
Project tigm

Sequence tag IST13247A4HMF1
Sequence
ATCTCATTTCTATTCAATTAATATTCCTGAGCAAATAACATTTTCCTTATTTGAAAAAAAATTGAAAAATTACAGTATGT
ATCTCTAGAACCATCCCCAAAACAAACAAAATCTGTCTCTTCCATTTATTTTTAACATTTATGATAATTGAACCTAGTTA
GAATAACTTTCTACTGTGTCCCANCCTAACCTTTTAAGTACTANATGTTCAAAATACTTTGTGTGANAAATTAACTTTCA
AAATAGAAAATTCCCACACTAACTGTACATCTATCATTGCCTGCTACCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651127..66651414 282
NO GENE  


Sequence tag IST13247A4HMR1
Sequence
AGANATGTTTAAAATATACATCCTAATGAATCCACTTAACTCCTGGTAAGAATTTCTTAAGTGTAGAAAATTAGCTCTTT
GAGAACCCCTTCAAACTGAAACTTTTTTTGTGTAATAACCAGAGTATTTTGTATTTCTTTAAGACATAATAGCTACAAGA
CAGGGTGGACAGGAGCACCAACAGCTTTGGAATCTGGGAGATACGTACTGTCTTGGTCC
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66651411..66651628 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]


Sequence tag IST13247A4BBF1
Sequence
ATCTCATTTCTATTNNATTAATATTCCTGAGCAAATAACATTTTCCTTATTTGAAAAAAAATTGAAAAATTACAGTATGT
ATCTCTAGAACCATCCCCAAAACAAACAAAATCTGTCTCTTCCNTTTATTTTNAACATTTATGANAATTGANCCTANTTN
NAANAACNTNCNNCTNTGTCCCAC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es