Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15035H12
Clone ID IST15035H12
Vector VICTR78
Project tigm

Sequence tag IST15035H12HMF2
Sequence
GTCTTCAATCAGTCTAATTAAGGCTTCAGCATTCTCAAGGCCCAGCTTCTGTTCTTTGATATAGTACGTGCCACCTTCAG
AGCCAAAACACAAGAAGCGGCGCAGCCGGTTCATGTCGGTGACCTGCCATACACAGCCGCCCTCTGAGTTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145617935..145618084 150
NO GENE  


Sequence tag IST15035H12BBF1
Sequence
AGGAGAGGAAATTCGGCCTCTGAGATAGCTAACCACAGCTTCCCCTCGCCCCCCTCC
Sequence Type genomic DNA
Unitrap ID UNI30619

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30917884..30917940 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es