Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AC0250
Clone ID AC0250
Vector pGT0lxr
Project sanger

Sequence tag AC0250
Sequence
AGAGGGAGGCATCATCGAGTCCACTAAGAACGAGTAGGATGAAGTCCATTCAAAGGCCTACCCACGACACACTGAAGCAG
CGGTGGCACAGCGGGATGAATGGAAAATGTTTATAGGAGGCCTTAGCTGGGACACCACAAAGAAAGATCTGAAGGACTAC
TTTTCCAAATTTGGTGAAGTTGTAGACTGCACTCTGAAGTTAGATCCTATCACAGGGCGATCAAGGGGTTTTGGCTTTGT
GCTATTTAAAGAGTCGTAGAGCGTAGATAAGC
Sequence Type mRNA
Unitrap ID UNI2881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 100396238..100405609 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000568 (Hnrnpd) NM_007516 heterogeneous nuclear ribonucleoprotein D Gene [Source:MGI Symbol;Acc:MGI:101947]

 
Come back to gene ENSMUSG00000000568


For any suggestions or comments, please send an email to unitrap@crg.es