Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13633A9
Clone ID IST13633A9
Vector VICTR74
Project tigm

Sequence tag IST13633A9HMR1
Sequence
GGGATGAGGCCNGCATTCTGAGGCCAGCTTCCCCTTGCTTAGCCCACAACATTGCTTGGTCCTCCACGGAGCANACCCGG
TCACTGGGTCACTGTGTTGTCTTCAGCTGACAATGGCAGATGGCCTGGCCTCAGAAACCCTGACCCAGAGGAGGCCTAGG
GAGCCTCAGATATACCGACTAAAAACTCCCTGATTCTAAATCCCAAGGTCACCTGCCTCAGTTTGTCAGGAATGGATTCT
GGTTTCGTGGGAGGGAGGGCTGGGGGGAGAGGCAAGGGCGGAGAGGAAGGAGTGAGGCGTGTATGTGGGTCTAGAACATT
CCCAGCAGGGTGAGGGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80865063..80865399 333
 
EST/CDNA Est Name
  BB822353.1 - BB302817.1 - BB816096.1 - BB818422.1 - BB837245.1 - BY377861.1 - BY376595.1 - BB747832.1 - BX529296.1


Sequence tag IST13633A9BBF1
Sequence
ATCCCCGGCCATACTAGGGAGCCACAGAAGGTTTTAGGGGGAAGGAGAATAGATAGGGTGGAGTGAGGAGGAGTTGTGGA
GTGGACAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI33704

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 80864974..80865067 94
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055053 (Nfic) NM_008688 nuclear factor I/C Gene [Source:MGI (curated);Acc:Nfic-004]

 
Come back to gene ENSMUSG00000055053


For any suggestions or comments, please send an email to unitrap@crg.es